Cambio - Excellence in Molecular Biology

Molecular Cloning Kits

Molecular Cloning Kits: RED/ET Kits

Selection Cassettes

Selection Cassettes

Gene Bridges

Catalogue No.DescriptionPack SizePriceQty
A001PGK-gb2-neo20ul at 50ng/ul £239.20 Quantity Add to Order
A002FRT-PGK-gb2-neo-FRT20ul at 50ng/ul £239.20 Quantity Add to Order
A003loxP-PGK-gb2-neo-loxP20ul at 50ng/ul £239.20 Quantity Add to Order
A004FRT-PGK-gb2-neo-FRT-loxP20ul at 50ng/ul £239.20 Quantity Add to Order
A005loxP-FRT-PGK-gb2-neo-FRT20ul at 50ng/ul £239.20 Quantity Add to Order
A006FRT-gb2-cm-FRT20ul at 50ng/ul £239.20 Quantity Add to Order
A007loxP-gb2-cm-loxP20ul at 50ng/ul £239.20 Quantity Add to Order
A008FRT-gb2-amp-FRT20ul at 50ng/ul £239.20 Quantity Add to Order
A009loxP-gb2-amp-loxP20ul at 50ng/ul £239.20 Quantity Add to Order
A010FRT-PGK-gb2-hygro-FRT20ul at 50ng/ul £239.20 Quantity Add to Order
A011loxP-PGK-gb2-hygro-loxP20ul at 50ng/ul £239.20 Quantity Add to Order
A012iCre-FRT-neo-FRT20ul at 50ng/ul £260.00 Quantity Add to Order
A013iCreERT2-FRT-neo-FRT20ul at 50ng/ul £260.00 Quantity Add to Order

Selection Cassettes

Selection Cassettes

Gene Bridges

Also available are accessory selection cassettes designed for use in Eu- or Prokaryotes, some flanked by loxP- or FRT-sites.

These sites will allow the subsequent removal of the selection marker by a Cre- or FLP-recombinase step if required. These cassettes may be very helpful for generating targeting constructs in mammals, or for introducing sequences without leaving a selection marker behind.

Please refer to protocol for full technical description.

A001 - PGK-gb2-neo - Pro- and Eukaryotic Neomycin Selection Cassette

A002 - FRT-PGK-gb2-neo-FRT - Pro- and Eukaryotic Neomycin Selection Cassette flanked by FRT-sites

A003 - loxP-PGK-gb2-neo-loxP - Pro- and Eukaryotic Neomycin Selection Cassette flanked by loxP-sites

A004 - FRT-PGK-gb2-neo-FRT-loxP - Pro- and Eukaryotic Neomycin Selection Cassette flanked by FRT-sites and one additional downstream loxP site

A005 - loxP-FRT-PGK-gb2-neo-FRT - Pro- and Eukaryotic Neomycin Selection Cassette flanked by FRT-sites and one additional upstream loxP site

A006 - loxP-FRT-PGK-gb2-neo-FRT - Prokaryotic Chloramphenicol Selection Cassette flanked by FRT-sites

A007 - loxP-gb2-cm-loxP - Prokaryotic Chloramphenicol Selection Cassette flanked by loxP-sites

A008 - FRT-gb2-amp-FRT - Prokaryotic Ampicillin Selection Cassette flanked by FRT-sites

A009 - loxP-gb2-amp-loxP - Prokaryotic Ampicillin Selection Cassette flanked by loxP-sites

A010 FRT-flanked, pro- and eukaryotic hygromycin selection cassette

A011 loxP flanked, pro- and eukaryotic hygromycin selection cassette

 

A001 - PGK-gb2-neo - Pro- and Eukaryotic Neomycin Selection Cassette

Selection Cassette A001

The PGK-gb2-neo template is designed to allow neomycin / kanamycin selection in prokaryotic and eukaryotic cells.

The PGK-gb2-neo template encodes the neomycin / kanamycin resistance gene which combines a prokaryotic promoter (gb2) for expression of kanamycin resistance in E. coli with a eukaryotic promoter (PGK) for expression of neomycin resistance in mammalian cells. The prokaryotic promoter gb2 is a slightly modified version of the Em7 promoter. It mediates higher transcription efficiency than the normally used Tn5 promoter. The promoter of the mouse phosphoglucokinase gene (PGK) is used as eukaryotic promoter. A synthetic polyadenylation signal terminates the kanamycin / neomycin expression. Using the provided PCR template one can easily create a PGK-gb2-neo cassette flanked by any restriction sites to clone the cassette into the vector of choice. The restriction sites can be introduced by adding the corresponding sequence in the PCR primer. The template can easily be used to generate targeting constructs mediated by a single Red/ET recombination step.

The PGK-gb2-neo template is not linear but plasmid based (3,377 bp in size). Due to its R6K origin it can not replicate in most of the E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1 µl per reaction as template.

Contents

  • PCR template (50 ng/µl, 20 µl)

  • manual

Sequences

PGK-gb2-neo

promoter  neoR   terminator

GCGGCCGCATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCAT GCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCTCGC ACACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCT TCGCGCCACCTTCCACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCT CGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAG ATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAAT AGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGG GGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGA GGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTT CCTCATCTCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGG CATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGGGATC GGCCATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGG CTATTCGGCTATGACTGGGCACAACAGACGATCGGCTGCTCTGATGCCGCCGTGT TCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGG TGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACG GGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGC TGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGC CGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCG GCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTC GGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCT CGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGAT CTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCC GCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGA CATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGAC CGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCT ATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAATAAAGACCG ACCAAGCGACGTCTGAGAGCTCCCTGGCGAATTCGGTACCAATAAAAGAGCTTTA TTTTCATGATCTGTGTGTTGGTTTTTGTGTGCGGCGCGCTCGAG


 

A002 - FRT-PGK-gb2-neo-FRT - Pro- and Eukaryotic Neomycin Selection Cassette flanked by FRT-sites


Selection Cassette A002

 

The FRT-PGK-gb2-neo-FRT template is designed to allow neomycin / kanamycin selection in prokaryotic and eukaryotic cells.

The FRT-PGK-gb2-neo-FRT template encodes the neomycin / kanamycin resistance gene which combines a prokaryotic promoter (gb2) for expression of kanamycin resistance in E. coli with a eukaryotic promoter (PGK) for expression of neomycin resistance in mammalian cells. The prokaryotic promoter gb2 is a slightly modified version of the Em7 promoter. It mediates higher transcription efficiency than the normally used Tn5 promoter. The promoter of the mouse phosphoglucokinase gene (PGK) is used as eukaryotic promoter. A synthetic polyadenylation signal terminates the kanamycin/neomycin expression. The cassette is flanked by FRT sites for later excision by Flp recombinase. Using the provided PCR template one can easily create a FRT-PGK-gb2-neo-FRT cassette flanked by any restriction sites to clone the cassette into the vector of choice. The restriction sites can be introduced by adding the corresponding sequence in the PCR primer. The template can easily be used to generate targeting constructs mediated by a single Red/ET recombination step.

The FRT-PGK-gb2-neo-FRT template is not linear but plasmid based (3,446 bp in size). Due to its R6K origin it can not replicate in most of the E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1 µl per reaction as template.

 

Contents

  • FRT-PGK-gb2-neo-FRT: PCR template (50 ng/µl, 20 µl)

  • manual

Sequences

FRT-PGK-gb2-neo-FRT

FRT  promoter  neoR  treminator
 
AATTAACCCTCACTAAAGGGCGGCCGCGAAGTTCCTATTCTCTAGAAAGTATAGG AACTTCATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGC GCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCA CACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTT CGCGCCACCTTCCACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTC GCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGA TGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATA GCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGG GGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAG GCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTC CTCATCTCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGC ATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGGGATCG GCCATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGC TATTCGGCTATGACTGGGCACAACAGACGATCGGCTGCTCTGATGCCGCCGTGTT CCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGT GCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGG GCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCT GCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCC GAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGG CTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCG GATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTC GCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATC TCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCG CTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGAC ATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACC GCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTA TCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAATAAAGACCGA CCAAGCGACGTCTGAGAGCTCCCTGGCGAATTCGGTACCAATAAAAGAGCTTTAT TTTCATGATCTGTGTGTTGGTTTTTGTGTGCGGCGCGGAAGTTCCTATTCTCTAG AAAGTATAGGAACTTCCTCGAGCCCTATAGTGAGTCGTATTA

 



 A003 - loxP-PGK-gb2-neo-loxP - Pro- and Eukaryotic Neomycin Selection Cassette flanked by loxP-sites

Selection Cassette A003

 

The loxP-PGK-gb2-neo-loxP template is designed to allow neomycin / kanamycin selection in prokaryotic and eukaryotic cells.

The loxP-PGK-gb2-neo-loxP template encodes the neomycin / kanamycin resistance gene which combines a prokaryotic promoter (gb2) for expression of kanamycin resistance in E. coli with a eukaryotic promoter (PGK) for expression of neomycin resistance in mammalian cells. The prokaryotic promoter gb2 is a slightly modified version of the Em7 promoter. It mediates higher transcription efficiency than the normally used Tn5 promoter. The promoter of the mouse phosphoglucokinase gene (PGK) is used as eukaryotic promoter. A synthetic polyadenylation signal terminates the kanamycin / neomycin expression. The cassette is flanked by loxP sites for later excision by Cre recombinase. Using the provided PCR template one can easily create a loxP-PGK-gb2-neo-loxP cassette flanked by any restriction sites to clone the cassette into the vector of choice. The restriction sites can be introduced by adding the corresponding sequence in the PCR primer. The template can easily be used to generate targeting constructs mediated by a single Red/ET recombination step.

The loxP-PGK-gb2-neo-loxP template is not linear but plasmid based (3,446 bp in size). Due to its R6K origin it can not replicate in most E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1 µl per reaction as template.

 

Contents

  • loxP-PGK-gb2-neo-loxP: PCR template (50 ng/µl, 20 µl)

  • manual

Sequences

loxP-PGK-gb2-neo-loxP

loxP  promoter  neoR  terminator
 
AATTAACCCTCACTAAAGGGCGGCCGCATAACTTCGTATAGCATACATTATACGA AGTTATATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGC GCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCA CACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCGT CGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTC GCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGA TGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATA GCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGG GGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAG GCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTC CTCATCTCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGC ATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGGGATCG GCCATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGC TATTCGGCTATGACTGGGCACAACAGACGATCGGCTGCTCTGATGCCGCCGTGTT CCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGT GCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGG GCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCT GCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCC GAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGG CTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCG GATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTC GCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATC TCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCG CTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGAC ATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACC GCTTCCTCGTGCTTTACGGTATCGCCGCCCCCGATTCGCAGCGCATCGCCTTCTA TCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAATAAAGACCGA CCAAGCGACGTCTGAGAGCTCCCTGGCGAATTCGGTACCAATAAAAGAGCTTTAT TTTCATGATCTGTGTGTTGGTTTTTGTGTGCGGCGCGATAACTTCGTATAGCATA CATTATACGAAGTTATCTCGAGCCCTATAGTGAGTCGTATTA





A004 - FRT-PGK-gb2-neo-FRT-loxP - Pro- and Eukaryotic Neomycin Selection Cassette flanked by FRT-sites and one additional downstream loxP site

Selection Cassette A004

 

The PGK-gb2-neo-FRT-loxP template is designed to allow kanamycin / neomycin selection in prokaryotic and eukaryotic cells, respectively.

It combines a prokaryotic promoter (gb2) for expression of kanamycin resistance in E. coli with a eukaryotic promoter (PGK) for expression of neomycin resistance in mammalian cells. The prokaryotic promoter gb2 is a slightly modified version of the Em7 promoter; it mediates higher transcription efficiency than the generally used Tn5 promoter. The promoter of the mouse phosphoglucokinase gene (PGK) is used as the eukaryotic promoter. A synthetic polyadenylation signal terminates the kanamycin / neomycin expression. The cassette is flanked by FRT sites for later excision by Flp recombinase. An additional single loxP site is located at the 3’ end of the cassette. Unique NotI and XhoI sites flank the cassette for convenient cloning with restriction sites. Using the provided PCR template one can easily create a PGK-gb2-neo-FRT-loxP cassette flanked by any other restriction sites to clone the cassette into the vector of choice. The restriction sites can be introduced by adding the corresponding sequence in the PCR primer. The template can easily be used to generate targeting constructs mediated by Red/ET recombination.

The PGK-gb2-neo-FRT-loxP template is not linear but plasmid based (3,485 bp in size). Due to its R6K origin the plasmid cannot replicate in most E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1 µl per reaction as template.

 

Contents

  • FRT-PGK-gb2-neo-FRT-loxP: PCR template (50 ng/µl, 20 µl)

  • manual

Sequences

FRT-PGK-gb2-neo-FRT-loxP

FRT  promoter  neoR  loxP  terminator

 
AATTAACCCTCACTAAAGGGCGGCCGCGAAGTTCCTATTCTCTAGAAAGTATAGG AACTTCATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGC GCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCA CACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTT CGCGCCACCTTCCACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTC GCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGA TGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATA GCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGG GGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAG GCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTC CTCATCTCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGC ATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGGGATCG GCCATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGC TATTCGGCTATGACTGGGCACAACAGACGATCGGCTGCTCTGATGCCGCCGTGTT CCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGT GCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGG GCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCT GCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCC GAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGG CTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCG GATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTC GCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATC TCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCG CTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGAC ATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACC GCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTA TCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAATAAAGACCGA CCAAGCGACGTCTGAGAGCTCCCTGGCGAATTCGGTACCAATAAAAGAGCTTTAT TTTCATGATCTGTGTGTTGGTTTTTGTGTGCGGCGCGGAAGTTCCTATTCTCTAG AAAGTATAGGAACTTCAAGCTTATAACTTCGTATAGCATACATTATACGAAGTTA TCTCGAGCCCTATAGTGAGTCGTATTA
 





A005 - loxP-FRT-PGK-gb2-neo-FRT - Pro- and Eukaryotic Neomycin Selection Cassette flanked by FRT-sites and one additional upstream loxP site

Selection Cassette A005

 

The loxP-FRT-PGK-gb2-neo-FRT template is designed to allow kanamycin / neomycin selection in prokaryotic and eukaryotic cells, respectively.

It combines a prokaryotic promoter (gb2) for expression of kanamycin resistance in E. coli with a eukaryotic promoter (PGK) for expression of neomycin resistance in mammalian cells. The prokaryotic promoter gb2 is a slightly modified version of the Em7 promoter. It mediates higher transcription efficiency than the generally used Tn5 promoter. The promoter of the mouse phosphoglucokinase gene (PGK) is used as the eukaryotic promoter. A synthetic polyadenylation signal terminates the kanamycin / neomycin expression. The cassette is flanked by FRT sites for later excision by Flp recombinase. An additional single loxP site is located at the 5’ end of the cassette. Unique NotI and XhoI sites flank the cassette for convenient cloning with restriction sites. Using the provided PCR template one can easily create a loxP-FRT-PGK-gb2-neo-FRT cassette flanked by any other restriction sites to clone the cassette into the vector of choice. The restriction sites can be introduced by adding the corresponding sequence in the PCR primer. The template can easily be used to generate targeting constructs mediated by Red/ET recombination.

The loxP-FRT-PGK-gb2-neo-FRT template is not linear but plasmid based (3,485 bp in size). Due to its R6K origin the plasmid cannot replicate in most E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1 µl per reaction as template.

 

Contents

  • loxP-FRT-PGK-gb2-neo-FRT: PCR template (50 ng/µl, 20 µl)

  • manual

Sequences

loxP-FRT-PGK-gb2-neo-FRT

loxP  FRT  promoter  neoR  terminator
 
AATTAACCCTCACTAAAGGGCGGCCGCATAACTTCGTATAATGTATGCTATACGA AGTTATAAGCTTGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCATTCTACCG GGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCG CTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCA CCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCCAC TCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACG TGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTG AGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTT CGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGC GGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCA CGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGGGCCT TTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGCATAGTATATCGGCAT AGTATAATACGACAAGGTGAGGAACTAAACCATGGGATCGGCCATTGAACAAGAT GGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACT GGGCACAACAGACGATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCA GGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTG CAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAG CTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGT GCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATC ATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCG ACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCT TGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTG TTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATG GCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCAT CGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACC CGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTT ACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGA GTTCTTCTGAGCGGGACTCTGGGGTTCGAATAAAGACCGACCAAGCGACGTCTGA GAGCTCCCTGGCGAATTCGGTACCAATAAAAGAGCTTTATTTTCATGATCTGTGT GTTGGTTTTTGTGTGCGGCGCGGAAGTTCCTATTCTCTAGAAAGTATAGGAACTT CCTCGAGCCCTATAGTGAGTCGTATTA





A006 - loxP-FRT-PGK-gb2-neo-FRT - Prokaryotic Chloramphenicol Selection Cassette flanked by FRT-sites

Selection Cassette A006

 

The FRT-cm-FRT cassette is designed to allow chloramphenicol selection in prokaryotic cells. The prokaryotic promoter gb2 driving the gene for chloramphenicol resistance is a slightly modified version of the Em7 promoter. It mediates higher transcription efficiency than the generally used Tn5 promoter. A synthetic polyadenylation signal terminates the chloramphenicol expression. The cassette is flanked by FRT sites for later excision by Flp recombinase. Unique NotI and XhoI sites flank the cassette for convenient cloning with restriction sites. Using the provided PCR template one can easily create a FRT-cm-FRT cassette flanked by any other restriction sites to clone the cassette into the vector of choice. The restriction sites can be introduced by adding the corresponding sequence in the PCR primer. The template can easily be used to engineer the E.coli genome by Red/ET recombination.

The FRT-cm-FRT cassette is not linear but plasmid based (3,302 bp in size). Due to its R6K origin the plasmid cannot replicate in most E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1 µl per reaction as template.

 

Contents

  • FRT-cm-FRT: PCR template (50 ng/µl, 20 µl)

  • manual

Sequences

FRT-gb2-cm-FRT

FRT  promoter  cmR  terminator
 
AATTAACCCTCACTAAAGGGCGGCCGCGAAGTTCCTATTCTCTAGAAAGTATAGG AACTTCATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGC GCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCA CACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTT CGCGCCACCTTCCACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTC GCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGA TGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATA GCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGG GGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAG GCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTC CTCATCTCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGC ATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGGAGAAA AAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATT TTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGA TATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCC TTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAA TGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTT CCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTC CGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGG CCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTG GGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCC CCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGC TGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCT TAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAGCGGGACTC TGGGGTTCGAATAAAGACCGACCAAGCGACGTCTGAGAGCTCCCTGGCGAATTCG GTACCAATAAAAGAGCTTTATTTTCATGATCTGTGTGTTGGTTTTTGTGTGCGGC GCGGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCCTCGAGCCCTATAGTGAG
TCGTATTA





A007 - loxP-gb2-cm-loxP - Prokaryotic Chloramphenicol Selection Cassette flanked by loxP-sites

Selection Cassette A007

 

The loxP-cm-loxP cassette is designed to allow chloramphenicol selection in prokaryotic cells. The prokaryotic promoter gb2 driving the gene for chloramphenicol resistance is a slightly modified version of the Em7 promoter. It mediates higher transcription efficiency than the generally used Tn5 promoter. A synthetic polyadenylation signal terminates the chloramphenicol expression. The cassette is flanked by loxP sites for later excision by Cre recombinase. Unique NotI and XhoI sites flank the cassette for convenient cloning with restriction sites. Using the provided PCR template one can easily create a loxP-cm-loxP cassette flanked by any other restriction sites to clone the cassette into the vector of choice. The restriction sites can be introduced by adding the corresponding sequence in the PCR primer. The template can easily be used to engineer the E. coli genome by Red/ET recombination.

The loxP-cm-loxP cassette is not linear but plasmid based (3,301 bp in size). Due to its R6K origin the plasmid cannot replicate in most E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1 µl per reaction as template.

 

Contents

  • loxP-cm-loxP: PCR template (50 ng/µl, 20 µl)

  • manual

Sequences

loxP-gb2-cm-loxP

loxP  promoter  cmR  terminator
 
AATTAACCCTCACTAAAGGGCGGCCGCATAACTTCGTATAGCATACATTATACGA AGTTATATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGC GCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCA CACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTT CGCGCCACCTTCCACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTC GCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGA TGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATA GCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGG GGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAG GCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTC CTCATCTCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGC ATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGGAGAAA AAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATT TTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGA TATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCC TTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAA TGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTT CCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTC CGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGG CCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTG GGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCC CCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGC TGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCT TAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAGCGGGACTC TGGGGTTCGAATAAAGACCGACCAAGCGACGTCTGAGAGCTCCCTGGCGAATTCG GTACCAATAAAAGAGCTTTATTTTCATGATCTGTGTGTTGGTTTTTGTGTGCGGC GCGATAACTTCGTATAGCATACATTATACGAAGTTATCTCGAGCCCTATAGTGAG
TCGTATTA
 

 


 

A008 - FRT-gb2-amp-FRT - Prokaryotic Ampicillin Selection Cassette flanked by FRT-sites

Selection Cassette A008

 

The FRT-amp-FRT cassette is designed to allow ampicillin selection in prokaryotic cells. The prokaryotic promoter gb2 driving the gene for ampicillin resistance is a slightly modified version of the Em7 promoter. It mediates higher transcription efficiency than the generally used Tn5 promoter. A synthetic polyadenylation signal terminates the ampicillin expression. The cassette is flanked by FRT sites for later excision by Flp recombinase. Unique NotI and XhoI sites flank the cassette for convenient cloning with restriction sites. Using the provided PCR template one can easily create a FRT-amp-FRT cassette flanked by any other restriction sites to clone the cassette into the vector of choice. The restriction sites can be introduced by adding the corresponding sequence in the PCR primer. The template can easily be used to engineer the E. coli genome by Red/ET recombination.

The FRT-amp-FRT cassette is not linear but plasmid based (3,502 bp in size). Due to its R6K origin the plasmid cannot replicate in most E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1 µl per reaction as template.

 

Contents

  • FRT-amp-FRT: PCR template (50 ng/µl, 20 µl)

  • manual

Sequence

FRT  promoter  ampR  terminator
 
AATTAACCCTCACTAAAGGGCGGCCGCGAAGTTCCTATTCTCTAGAAAGTATAGG AACTTCATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGC GCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCA CACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTT CGCGCCACCTTCCACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTC GCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGA TGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATA GCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGG GGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAG GCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTC CTCATCTCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGC ATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGAGTATT
CAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTCGCCTTCCTGTTT
TTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGC
ACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTT
CGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCG
CGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTA
TTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGAT
GGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTG
CGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTT
GCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAAT
GAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAA
CGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATT
AATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTT
CCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCG
GTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTA
CACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATA
GGTGCCTCACTGATTAAGCATTGGTAAGCGGGACTCTGGGGTTCGAATAAAGACC
GACCAAGCGACGTCTGAGAGCTCCCTGGCGAATTCGGTACCAATAAAAGAGCTTT
ATTTTCATGATCTGTGTGTTGGTTTTTGTGTGCGGCGCGGAAGTTCCTATTCTCT
AGAAAGTATAGGAACTTCCTCGAGCCCTATAGTGAGTCGTATTA



 A009 - loxP-gb2-amp-loxP - Prokaryotic Ampicillin Selection Cassette flanked by loxP-sites

Selection Cassette A009

 

The loxP-amp-loxP cassette is designed to allow ampicillin selection in prokaryotic cells. The prokaryotic promoter gb2 driving the gene for ampicillin resistance is a slightly modified version of the Em7 promoter. It mediates higher transcription efficiency than the generally used Tn5 promoter. A synthetic polyadenylation signal terminates the ampicillin expression. The cassette is flanked by lox sites for later excision by Cre recombinase. Unique NotI and XhoI sites flank the cassette for convenient cloning with restriction sites. Using the provided PCR template one can easily create a loxP-amp-loxP cassette flanked by any other restriction sites to clone the cassette into the vector of choice. The restriction sites can be introduced by adding the corresponding sequence in the PCR primer. The template can easily be used to engineer the E. coli genome by Red/ET recombination.

The loxP-amp-loxP cassette is not linear but plasmid based (3,502 bp in size). Due to its R6K origin the plasmid cannot replicate in most E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1 µl per reaction as template.

 

Contents

  • loxP-amp-loxP: PCR template (50 ng/µl, 20 µl)

  • manual

Sequences

loxP-gb2-amp-loxP

loxP  promoter  ampR  terminator
 
AATTAACCCTCACTAAAGGGCGGCCGCATAACTTCGTATAGCATACATTATACGA AGTTATATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGC GCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCA CACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTT CGCGCCACCTTCCACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTC GCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGA TGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATA GCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGG GGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAG GCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTC CTCATCTCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGC ATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGAGTATT CAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTT TTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGC ACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTT CGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCG CGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTA TTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGAT GGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTG CGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTT GCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAAT GAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAA CGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATT AATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTT CCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCG GTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTA CACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATA GGTGCCTCACTGATTAAGCATTGGTAAGCGGGACTCTGGGGTTCGAATAAAGACC GACCAAGCGACGTCTGAGAGCTCCCTGGCGAATTCGGTACCAATAAAAGAGCTTT ATTTTCATGATCTGTGTGTTGGTTTTTGTGTGCGGCGCGATAACTTCGTATAGCA TACATTATACGAAGTTATCTCGAGCCCTATAGTGAGTCGTATTA

 


 

A010 FRT-flanked, pro- and eukaryotic hygromycin selection cassette

A010

The FRT-PGK-gb2-hygro-FRT template was designed to allow hygromycin selection in prokaryotic and eukaryotic cells. 

The FRT-PGK-gb2-hygro-FRT template encodes the hygromycin resistance gene which combines a prokaryotic promoter (gb2) for expression in E. coli with a eukaryotic promoter (PGK) for expression in mammalian cells.

The prokaryotic promoter gb2 is a slightly modified version of the Em7 promoter; it mediates higher transcription efficiency than the normally used Tn5 promoter. The promoter of the mouse phosphoglucokinase gene (PGK) is used as eukaryotic promoter. A synthetic polyadenylation signal terminates the hygromycin expression. The cassette is flanked by FRT sites for later excision by FLP recombinase.

Using the provided PCR template one can easily create a FRT-PGK-gb2-hygro-FRT cassette flanked by any restriction sites to clone the cassette into the vector of choice. The restriction sites can be introduced by adding the corresponding sequence in the PCR primer. The template can easily be used to generate targeting constructs mediated by a single Red/ET recombination step.

The FRT-PGK-gb2-hygro-FRT template is not linear but plasmid based (3,643 bp in size). Due to its R6K origin it can not replicate in most of the E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1µl per reaction as template

Contents

  • FRT-PGK-gb2-hygro-FRT: PCR template (50 ng/µl, 20 µl)

  • manual

Sequences

FRT-PGK-gb2-hygro-FRT

FRT  promoter  hygroR  terminator
 
AATTAACCCTCACTAAAGGGCGGCCGCGAAGTTCCTATTCTCTAGAAAGTATAGG AACTTCATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGC GCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCA CACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCGT CGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTC GCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGA TGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATA GCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGG GGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAG GCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTC CTCATCTCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGC ATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGAAAAAG CCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCG TCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCGA TGTAGGAGGGCGTGGATACGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTAC AAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAG TGCTTGACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGC ACAGGGTGTCACGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTGCAG CCGGTCGCGGAGGCCATGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCG GGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTGATTT CATATGCGCGATTGCTGATCCCCATGTGTATCACTGGCAAACTGTGATGGACGAC ACCGTCAGTGCGTCCGTCGCGCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGG ACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATTTCGGCTCCAACAATGTCCT GACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGG GATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGTTGGCTTGTA TGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGATCGCC GCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTG GTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCG TCCGATCCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGC CGTCTGGACCGATGGCTGTGTAGAAGTACTTGCCGATAGTGGAAACCGACGCCCC AGCACTCGTCCGAGGGCAAAGGAATAGGTTTCCCTGCCACAGTCTGAGAGCTCCC TGGCGAATTCGGTACCAATAAAAGAGCTTTATTTTCATGATCTGTGTGTTGGTTT TTGTGTGCGGCGCGGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCCTCGAGC
CCTATAGTGAGTCGTATTA
 

 
A011 loxP flanked, pro- and eukaryotic hygromycin selection cassette
 
A011

The loxP-PGK-gb2-hygro-loxP template is designed to allow hygromycin selection in prokaryotic and eukaryotic cells. 

The loxP-PGK-gb2-hygro-loxP template encodes the hygromycin resistance gene which combines a prokaryotic promoter (gb2) for expression in E. coli with a eukaryotic promoter (PGK) for expression in mammalian cells.

The prokaryotic promoter gb2 is a slightly modified version of the Em7 promoter; it mediates higher transcription efficiency than the normally used Tn5 promoter. The promoter of the mouse phosphoglucokinase gene (PGK) is used as eukaryotic promoter. A synthetic polyadenylation signal terminates the hygromycin expression. The cassette is flanked by loxP sites for later excision by Cre recombinase.

Using the provided PCR template one can easily create a loxP-PGK-gb2-hygro-loxP cassette flanked by any restriction sites to clone the cassette into the vector of choice. The restriction sites can be introduced by adding the corresponding sequence in the PCR primer. The template can easily be used to generate targeting constructs mediated by a single Red/ET recombination step.

The loxP-PGK-gb2-hygro-loxP template is not linear but plasmid based (3,643 bp in size). Due to its R6K origin it can not replicate in most of the E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1µl per reaction as template.

Contents

  • loxP-PGK-gb2-hygro-loxP: PCR template (50 ng/µl, 20 µl)

  • manual

Sequences

loxP-PGK-gb2-hygro-loxP

loxP  promoter  hygroR  terminator
 
AATTAACCCTCACTAAAGGGCGGCCGCATAACTTCGTATAGCATACATTATACGA AGTTATATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGC GCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCA CACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCGT CGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTC GCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGA TGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATA GCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGG GGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAG GCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTC CTCATCTCCGGGCCTTTCGACCTGCAGCAGCACGTGTTGACAATTAATCATCGGC ATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGAAAAAG CCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCG TCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCGA TGTAGGAGGGCGTGGATACGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTAC AAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAG TGCTTGACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGC ACAGGGTGTCACGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTGCAG CCGGTCGCGGAGGCCATGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCG GGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTGATTT CATATGCGCGATTGCTGATCCCCATGTGTATCACTGGCAAACTGTGATGGACGAC ACCGTCAGTGCGTCCGTCGCGCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGG ACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATTTCGGCTCCAACAATGTCCT GACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGG GATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGTTGGCTTGTA TGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGATCGCC GCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTG GTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCG TCCGATCCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGC CGTCTGGACCGATGGCTGTGTAGAAGTACTTGCCGATAGTGGAAACCGACGCCCC AGCACTCGTCCGAGGGCAAAGGAATAGGTTTCCCTGCCACAGTCTGAGAGCTCCC TGGCGAATTCGGTACCAATAAAAGAGCTTTATTTTCATGATCTGTGTGTTGGTTT TTGTGTGCGGCGCGATAACTTCGTATAGCATACATTATACGAAGTTATCTCGAGC
CCTATAGTGAGTCGTATTA
 

 
A012 Codon improved Cre (iCre) with attached FRT flanked, pro- and eukaryotic neomycin selection cassette
 
A012
 

iCre-FRT-neo-FRT PCR template is designed to facilitate the insertion of such a functional cassette into targeting constructs by Red/ET recombination. A codon-improved version of P1 bacteriophage derived Cre recombinase is located upstream of the neomycin / kanamycin resistance gene (aminoglycoside phosphotransferase). Mammalian codon usage was applied for the altered Cre version (iCre). By introducing silent base mutations the high CpG content of the prokaryotic coding sequence was reduced, thereby reducing the chances of epigenetic silencing in mammals (Cohen-Tannoudji et al., 2000).

The iCre-FRT-neo-FRT template encodes the neomycin / kanamycin resistance gene which combines a prokaryotic promoter (gb2) for kanamycin resistance in E. coli with a eukaryotic promoter (PGK) for neomycin resistance in mammalian cells. The prokaryotic promoter gb2 is a slightly modified version of the Em7 promoter; it mediates higher transcription efficiency than the normally used Tn5 promoter. The promoter of the mouse phosphoglycerate kinase gene (PGK) is used as eukaryotic promoter. A synthetic polyadenylation signal terminates the kanamycin / neomycin transcription. The cassette is flanked by FRT sites for later excision by Flp recombinase. Using the provided PCR template one can easily create an iCre-FRT-neo-FRT cassette flanked by homology arms to insert the cassette by Red/ET recombination into the vector of choice.

The iCre-FRT-neo-FRT template is not linear but plasmid based (3,446bp in size). Due to its R6K origin it can’t replicate in most of the common E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1 µl per reaction as template.

Contents

  • iCre-FRT-PGK-gb2-neo-FRT: PCR template (50 ng/µl, 20 µl)

  • manual

Sequences

iCre-FRT-neo-FRT

Cre  FRT  neoR
 
ATGGTCTCCAACCTGCTGACTGTGCACCAAAACCTGCCTGCCCTCCCTGTGGATG CCACCTCTGATGAAGTCAGGAAGAACCTGATGGACATGTTCAGGGACAGGCAGGC CTTCTCTGAACACACCTGGAAGATGCTCCTGTCTGTGTGCAGATCCTGGGCTGCC TGGTGCAAGCTGAACAACAGGAAATGGTTCCCTGCTGAACCTGAGGATGTGAGGG ACTACCTCCTGTACCTGCAAGCCAGAGGCCTGGCTGTGAAGACCATCCAACAGCA CCTGGGCCAGCTCAACATGCTGCACAGGAGATCTGGCCTGCCTCGCCCTTCTGAC TCCAATGCTGTGTCCCTGGTGATGAGGAGAATCAGAAAGGAGAATGTGGATGCTG GGGAGAGAGCCAAGCAGGCCCTGGCCTTTGAACGCACTGACTTTGACCAAGTCAG ATCCCTGATGGAGAACTCTGACAGATGCCAGGACATCAGGAACCTGGCCTTCCTG GGCATTGCCTACAACACCCTGCTGCGCATTGCCGAAATTGCCAGAATCAGAGTGA AGGACATCTCCCGCACCGATGGTGGGAGAATGCTGATCCACATTGGCAGGACCAA GACCCTGGTGTCCACAGCTGGTGTGGAGAAGGCCCTGTCCCTGGGGGTTACCAAG CTGGTGGAGAGATGGATCTCTGTGTCTGGTGTGGCTGATGACCCCAACAACTACC TGTTCTGCCGGGTCAGAAAGAATGGTGTGGCTGCCCCTTCTGCCACCTCCCAACT GTCCACCCGGGCCCTGGAAGGGATCTTTGAGGCCACCCACCGCCTGATCTATGGT GCCAAGGATGACTCTGGGCAGAGATACCTGGCCTGGTCTGGCCACTCTGCCAGAG TGGGTGCTGCCAGGGACATGGCCAGGGCTGGTGTGTCCATCCCTGAAATCATGCA GGCTGGTGGCTGGACCAATGTGAACATTGTGATGAACTACATCAGAAACCTGGAC TCTGAGACTGGGGCCATGGTGAGGCTGCTCGAGGATGGGGACTGATGATGAAGAT CTGAGCTCCCTGGCGGAATTCGGATCCAGATCTTATTAAAGCAGAACTTGTTTAT TGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAA GCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTT ATCATGTCTGGTCGATAATACGACTCACTATAGGGCTCGAGGAAGTTCCTATACT TTCTAGAGAATAGGAACTTCCGCGCCGCACACAAAAACCAACACACAGATCATGA AAATAAAGCTCTTTTATTGGTACCGAATTCGCCAGGGAGCTCTCAGACGTCGCTT GGTCGGTCTTTATTCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGC GATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAA GCGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCT ATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAA AGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGAC GAGATCCTCGCCGTCGGGCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGC GCGAGCCCCTGATGCTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCA TCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGT AGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTC TCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATA GCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAAC GCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCAGTTCATTCAGG GCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCC GGAACACGGCGGCATCAGAGCAGCCGATCGTCTGTTGTGCCCAGTCATAGCCGAA TAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATG GCCGATCCCATGGTTTAGTTCCTCACCTTGTCGTATTATACTATGCCGATATACT ATGCCGATGATTAATTGTCAACACGTGCTGCTGCAGGTCGAAAGGCCCGGAGATG AGGAAGAGGAGAACAGCGCGGCAGACGTGCGCTTTTGAAGCGTGCAGAATGCCGG GCCTCCGGAGGACCTTCGGGCGCCCGCCCCGCCCCTGAGCCCGCCCCTGAGCCCG CCCCCGGACCCACCCCTTCCCAGCCTCTGAGCCCAGAAAGCGAAGGAGCAAAGCT GCTATTGGCCGCTGCCCCAAAGGCCTACCCGCTTCCATTGCTCAGCGGTGCTGTC CATCTGCACGAGACTAGTGAGACGTGCTACTTCCATTTGTCACGTCCTGCACGAC GCGAGCTGCGGGGCGGGGGGGAACTTCCTGACTAGGGGAGGAGTGGAAGGTGGCG CGAAGGGGCCACCAAAGAACGGAGCCGGTTGGCGCCTACCGGTGGATGTGGAATG TGTGCGAGGCCAGAGGCCACTTGTGTAGCGCCAAGTGCCCAGCGGGGCTGCTAAA GCGCATGCTCCAGACTGCCTTGGGAAAAGCGCCTCCCCTACCCGGTAGAATGAAG TTCCTATACTTTCTAGAGAATAGGAACTTCGCGGCGCCCTTTAGTGAGGGTTAAT

 
A013 Ligand-inducible iCre with attached FRT flanked, pro- and eukaryotic neomycin selection cassette
 

The iCreERT2-FRT-neo-FRT PCR template is designed to facilitate the insertion of such a functional cassette into targeting constructs by Red/ET recombination.

A codon-improved version of P1 bacteriophage derived Cre-recombinase is fused with the ligand-binding domain of the estrogen receptor (ER) to obtain a ligand-inducible recombinase. Mammalian codon usage was applied for the altered Cre version (iCre). By introducing silent base mutations the high CpG content of the prokaryotic coding sequence was reduced, thereby reducing the chances of epigenetic silencing in mammals.

The iCreERT2-FRT-neo-FRT template encodes the neomycin / kanamycin resistance gene (aminoglycoside phosphotransferase) which combines a prokaryotic promoter (gb2) for kanamycin resistance in E. coli with a eukaryotic promoter (PGK) for neomycin resistance in mammalian cells.

The prokaryotic promoter gb2 is a slightly modified version of the Em7 promoter; it mediates higher transcription efficiency than the normally used Tn5 promoter. The promoter of the mouse phosphoglycerate kinase gene (PGK) is used as eukaryotic promoter. A synthetic polyadenylation signal terminates the kanamycin/neomycin transcription. The cassette is flanked by FRT sites for later excision by Flp recombinase.

Using the provided PCR template one can easily create an iCre-FRT-neo-FRT cassette flanked by homology arms to insert the cassette by Red/ET recombination into the vector of choice. The template can easily be used to generate targeting constructs mediated by a single Red/ET recombination step.

The iCreERT2-FRT-neo-FRT template is not linear but plasmid based (4,185 bp in size). Due to its R6K origin it can’t replicate in most of the frequently used E. coli strains. The PCR product can therefore be used directly for downstream applications without any further purification. At least 20 PCR reactions can be performed using 1 µl per reaction as template.

Contents

  • iCreERT2-FRT-PGK-gb2-neo-FRT: PCR template (50 ng/µl, 20 µl)

  • manual

Sequences

iCreERT2-FRT-neo-FRT

iCreERT2  FRT  neoR  promoter
 
ATGGTCTCCAACCTGCTGACTGTGCACCAAAACCTGCCTGCCCTCCCTGTGGATG CCACCTCTGATGAAGTCAGGAAGAACCTGATGGACATGTTCAGGGACAGGCAGGC CTTCTCTGAACACACCTGGAAGATGCTCCTGTCTGTGTGCAGATCCTGGGCTGCC TGGTGCAAGCTGAACAACAGGAAATGGTTCCCTGCTGAACCTGAGGATGTGAGGG ACTACCTCCTGTACCTGCAAGCCAGAGGCCTGGCTGTGAAGACCATCCAACAGCA CCTGGGCCAGCTCAACATGCTGCACAGGAGATCTGGCCTGCCTCGCCCTTCTGAC TCCAATGCTGTGTCCCTGGTGATGAGGAGAATCAGAAAGGAGAATGTGGATGCTG GGGAGAGAGCCAAGCAGGCCCTGGCCTTTGAACGCACTGACTTTGACCAAGTCAG ATCCCTGATGGAGAACTCTGACAGATGCCAGGACATCAGGAACCTGGCCTTCCTG GGCATTGCCTACAACACCCTGCTGCGCATTGCCGAAATTGCCAGAATCAGAGTGA AGGACATCTCCCGCACCGATGGTGGGAGAATGCTGATCCACATTGGCAGGACCAA GACCCTGGTGTCCACAGCTGGTGTGGAGAAGGCCCTGTCCCTGGGGGTTACCAAG CTGGTGGAGAGATGGATCTCTGTGTCTGGTGTGGCTGATGACCCCAACAACTACC TGTTCTGCCGGGTCAGAAAGAATGGTGTGGCTGCCCCTTCTGCCACCTCCCAACT GTCCACCCGGGCCCTGGAAGGGATCTTTGAGGCCACCCACCGCCTGATCTATGGT GCCAAGGATGACTCTGGGCAGAGATACCTGGCCTGGTCTGGCCACTCTGCCAGAG TGGGTGCTGCCAGGGACATGGCCAGGGCTGGTGTGTCCATCCCTGAAATCATGCA GGCTGGTGGCTGGACCAATGTGAACATTGTGATGAACTACATCAGAAACCTGGAC TCTGAGACTGGGGCCATGGTGAGGCTGCTCGAGGATGGGGACCTCGAGCCATCTG CTGGAGACATGAGAGCTGCCAACCTTTGGCCAAGCCCGCTCATGATCAAACGCTC TAAGAAGAACAGCCTGGCCTTGTCCCTGACGGCCGACCAGATGGTCAGTGCCTTG TTGGATGCTGAGCCCCCCATACTCTATTCCGAGTATGATCCTACCAGACCCTTCA GTGAAGCTTCGATGATGGGCTTACTGACCAACCTGGCAGACAGGGAGCTGGTTCA CATGATCAACTGGGCGAAGAGGGTGCCAGGCTTTGTGGATTTGACCCTCCATGAT CAGGTCCACCTTCTAGAATGTGCCTGGCTAGAGATCCTGATGATTGGTCTCGTCT GGCGCTCCATGGAGCACCCAGTGAAGCTACTGTTTGCTCCTAACTTGCTCTTGGA CAGGAACCAGGGAAAATGTGTAGAGGGCATGGTGGAGATCTTCGACATGCTGCTG GCTACATCATCTCGGTTCCGCATGATGAATCTGCAGGGAGAGGAGTTTGTGTGCC TCAAATCTATTATTTTGCTTAATTCTGGAGTGTACACATTTCTGTCCAGCACCCT GAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGACAAGATCACAGAC ACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAGCACCAGC GGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAAGG CATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTG CTGCTGGAGGCGGCGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGG CATCCGTGGAGGAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCATC GCATTCCTTGCAAAAGTATTACATCACGGGGGAGGCAGAGGGTTTCCCTGCCACA GCTTGATGAAGATCTGAGCTCCCTGGCGGAATTCGGATCCAGATCTTATTAAAGC AGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAA TTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTC ATCAATGTATCTTATCATGTCTGGTCGATAATACGACTCACTATAGGGCTCGAGG AAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGCGCCGCACACAAAAACCAAC ACACAGATCATGAAAATAAAGCTCTTTTATTGGTACCGAATTCGCCAGGGAGCTC TCAGACGTCGCTTGGTCGGTCTTTATTCGAACCCCAGAGTCCCGCTCAGAAGAAC TCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGT AAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACG GGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCG ATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGC CATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCGCGCCTTGAGCCTGGCGAA CAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATCATCCTGATCGACA AGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGT CGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCAT GATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGC ACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAG CTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTG CAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCC TGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATCGTCTGTTGTGCCC AGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCC ATCTTGTTCAATGGCCGATCCCATGGTTTAGTTCCTCACCTTGTCGTATTATACT ATGCCGATATACTATGCCGATGATTAATTGTCAACACGTGCTGCTGCAGGTCGAA AGGCCCGGAGATGAGGAAGAGGAGAACAGCGCGGCAGACGTGCGCTTTTGAAGCG TGCAGAATGCCGGGCCTCCGGAGGACCTTCGGGCGCCCGCCCCGCCCCTGAGCCC GCCCCTGAGCCCGCCCCCGGACCCACCCCTTCCCAGCCTCTGAGCCCAGAAAGCG AAGGAGCAAAGCTGCTATTGGCCGCTGCCCCAAAGGCCTACCCGCTTCCATTGCT CAGCGGTGCTGTCCATCTGCACGAGACTAGTGAGACGTGCTACTTCCATTTGTCA CGTCCTGCACGACGCGAGCTGCGGGGCGGGGGGGAACTTCCTGACTAGGGGAGGA GTGGAAGGTGGCGCGAAGGGGCCACCAAAGAACGGAGCCGGTTGGCGCCTACCGG TGGATGTGGAATGTGTGCGAGGCCAGAGGCCACTTGTGTAGCGCCAAGTGCCCAG CGGGGCTGCTAAAGCGCATGCTCCAGACTGCCTTGGGAAAAGCGCCTCCCCTACC CGGTAGAATGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGCGGCGCCCTTT
AGTGAGGGTTAATT
 

If you cannot find the answer to your problem below then please contact us or telephone 01954 210 200

Selection Cassettes

Selection Cassettes

Gene Bridges

Protocols for: Selection Cassettes 

PGK-gb2-neo

(catalogue number A001) 

FRT-PGK-gb2-neo-FRT

(catalogue number A002) 

loxP-PGK-gb2-neo-loxP

(catalogue number A003) 

FRT-PGK-gb2-neo-loxP

(catalogue number A004) 

loxP-FRT-PGK-gb2-neo-FRT

(catalogue number A005)

FRT-gb2-cm-FRT

(catalogue number A006) 

loxP-gb2-cm-loxP

(catalogue number A007) 

FRT-gb2-amp-FRT

(catalogue number A008) 

loxP-gb2-amp-loxP

(catalogue number A009)

FRT-flanked, pro- and eukaryotic hygromycin selection cassette

(catalogue number A010)

loxP flanked, pro- and eukaryotic hygromycin selection cassette

(catalogue number A011)

Codon improved Cre (iCre) with attached FRT flanked, pro- and eukaryotic neomycin selection cassette

(catalogue number A012)

Ligand-inducible iCre with attached FRT flanked, pro- and eukaryotic neomycin selection cassette

(catalogue number A013)

 

  

Please note: all protocols off site are the responsibility of the products supplier

If you cannot find the answer to your problem below then please contact us or telephone 01954 210 200

Selection Cassettes

Selection Cassettes

Gene Bridges

Gene Bridges Publications

Ambrogio C, Stern P, Scuoppo C, Kranz H, Barbacid M and Santamaría D, 2014, Lentiviral-based approach for the validation of cancer therapeutic targets in vivo, BioTechniques, 57, 179

Vaisman A, McDonald JP, Noll S, Huston D, Loeb G, Goodmann MF and Woodgate R, 2014, Investigating the mechanisms of ribonucleotide excision repair in Escherichia coli, Mutation Res, 761, 21

Noll S, Reyelt J, Rysiok T, Kellner, R, Güssow D, Jäkel S, Hager S and Kranz H, 2013, Gezielte Optimierung von Escherichia coli BL21(DE3), Biospektrum, 19, 211

Hager S, Lösch S, Noll S, Khan-Vaughan L, Ehrlich ME and Kranz H, 2012, Red/ET recombination with chimeric oligonucleotides allows rapid generation of BAC transgene harboring full-length or truncated huntingtin cDNA, BioTechniques Rapid Dispatches, doi: 10.2144/000113908

Noll S, Hampp G, Bausbacher H, Pellegata NS and Kranz H, 2009, Site-directed mutagenesis of multi-copy-number plasmids: Red/ET recombination and unique restriction site elimination, BioTechniques, 46, 527

Braatsch S, Helmark S, Kranz H, Koebmann B and Jensen PR, 2008, Escherichia coli strains with promoter libraries constructed by Red/ET recombination pave the way for transcriptional fine-tuning, BioTechniques, 45, 335

Fu J, Wenzel SC, Perlova O, Wang J, Gross F, Tang Z, Yin Y, Stewart, AF, Müller R and Zhang Y, 2008, Efficient transfer of two large secondary metabolite pathway gene clusters into heterologous hosts by transposition, Nucleic Acids Research, 36, 17

Heermann R, Zeppenfeld T and Jung K, 2008, Simple generation of site-directed point mutations in the Escherichia coli chromosome using Red/ET Recombination, Microbial Cell Factories 7, 14

Lösch S, Braatsch S and Kranz H, 2007, Red/ET Recombination. λ vs. Mu: base-precise modification of the E. coli genome, BIOspektrum

Wang J, Sarov M, Rientjes J, Fu J, Hollak H, Kranz H, Xie W, Stewart AF and Zhang Y, 2006, An improved recombineering approach by adding RecA to lambda Red recombination, Mol Biotechnol, 32, 43

Zeppenfeld T and Kranz H, 2006, Manipulation des E. coli-Chromosoms zur Optimierung von Produktionsstämmen, Laborwelt, 5, 25

Zhang Y, Stevens G, Stewart AF, 2002, Ein neues Prinzip der DNA-Klonierung, LaborPraxis, 72

 

Citations

2013/2014: Strain modification & metabolic engineering approaches

Satoh et al., 2014, New gene responsible for para-aminobenzoate biosynthesis, J Bioscience and Bioeng, 117, 178

Jung et al., 2013, Removal of pathogenic factors from 2,3-butanediol-producing Klebsiella species by inactivating virulence-related wabG gene, Apppl Gen & Mol Biotech, 97, 1997

Wang et al., 2013, Engineering furfural tolerance in Escherichia coli improves the fermentation of lignocellulosic sugars into renewable chemicals, PNAS, 110, 4021

Pfander et al., 2013, Recombination-mediated genetic engineering of Plasmodium berghei DNA, Malaria, 923, 127

Howard et al., 2013, Synthesis of customized petroleum-replica fuel molecules by targeted modification of free fatty acid pools in Escherichia coli, PNAS, 110, 7636

Kim et al., 2013, Cloning and characterization of a putative UDP-rhamnose synthase 1 from Populus euramericana Guinier, J Plant Biol, 56, 7

Heinrich et al., 2013, From waste to plastic: Synthesis of pPpoly(3-Hydroxypropionate) in Shimwellia blattae, AEM, 79, 3582

Tan et al., 2013, Activating phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase in combination for improving succinate production, AEM, doi: 10.1128/AEM.00826-13

Kim et al., 2013, Biosynthesis of bioactive O-methylated flavonoids in Escherichia coli, AMB, 97, 7195

Arbel-Goren et al., 2013, Effects of post-transcriptional regulation on phenotypic noise in Escherichia coli, Nucleic Acid Res, 41, 4825

Wang et al., 2013, Engineered heterologous FPP synthases-mediated Z,E-FPP synthesis in E. coli, Metabolic Eng, 18, 53

Kim et al., 2013, Production of hydroxycinnamoyl-shikimates and chlorogenic acid in Escherichia coli: production of hydroxycinnamic acid conjugates, Microbiol Cell Factories, 12, 15

Xiao et al., 2013, Engineering Escherichia coli to convert acetic acid to free fatty acids, Biochem Engineering J, 76, 60

Cimini et al., 2013, Homologous overexpression of rfaH in E. coli K4 improves the production of chondroitin-like capsular polysaccharide, Microbial Cell Factories, 12, 46

2013/2014: Other approaches

Fried et al., 2013, Identification of a target gene and activating Stimulus for the YpdA/YpdB histidine kinase/response regulator system in Escherichia coli, J Bacteriol, 195, 807

Sivakamasundari et al., 2013, Pax1EGFP: New wildtype and mutant EGFP mouse lines for molecular and fate mapping studies, Genesis, 51, 420

Huong et al., 2013, In vivo analysis of aicda gene regulation: A critical balance between upstream enhancers and intronic silencers governs appropriate expression, PlosOne 8, e61433

Katsumata et al., 2013, Bioluminescence imaging of β cells and intrahepatic insulin gene activity under normal and pathological conditions, PlosOne, 8, e60411

Miyazaki et al., 2013, Galnt3 deficiency disrupts acrosome formation and leads to oligoasthenoteratozoospermia, Histochem & Cell Biol, 139, 339

Zhou et al., 2013, An essential function for the ATR-Activation-Domain (AAD) of TopBP1 in mouse development and cellular senescence, PlosGeneteics, 9, e1003702

Spatz et al., 2013, Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines, Virus Genes, 47, 259

Webber et al., 2013, The relationship between long-range chromatin occupancy and polymerization of the Drosophila ETS family transcriptional repressor Yan, Genetics, 193, 633

Sugimoto et al., 2013, Generation and characterization of ScxCre transgenic mice, Genesis, 51, 275

Nagase et al., 2013, Deiodinase 2 upregulation demonstrated in osteoarthritis patients cartilage causes cartilage destruction in tissue-specific transgenic rats, Osteoarthritis and Cartilage, 21, 514

Thomas et al., 2013, Piwi induces piRNA-guided transcriptional silencing and establishment of a repressive chromatin state, Genes&Dev, 27, 390

Schraml et al., 2013, Genetic tracing via DNGR-1 expression history defines dendritic cells as a hematopoietic lineage, Cell, 154, 843

Tanaka et al., 2013, Astrocytic Ca2 signals are required for the functional integrity of tripartite synapses, Molecular Brain, 6, 6

Akieda-Asai et al., 2013, Involvement of guanylin and GC-C in rat mesenteric macrophages in resistance to a high-fat diet, J Lip Res, 54, 85

Charleswort, 2013, Plant sex chromosome evolution, J Experi Botany, 64, 405

Chien et al., 2013, Misregulated progesterone secretion and impaired pregnancy in Cyp11a1 transgenic mice, Biol of Reproduction, doi:10.1095/biolreprod.113.110833

Manu et al., 2013, Sex-specific pattern formation during early Drosophila development, Genetics, 194, 163

Ogiwara et al., 2013, Nav1.1 haploinsufficiency in excitatory neurons ameliorates seizure-associated sudden death in a mouse model of Dravet syndrome, Hum Mol Genetics, 22, 4784

Sato et al., 2013, Fluoroquinolone resistance mechanisms in an Escherichia coli isolate, HUE1, without quinolone resistance-determining region mutations, Front Microbiol, 4, 125

Tanaka et al., 2013, Epigenetic Thpok silencing limits the time window to choose CD4 helper-lineage fate in the thymus, EMBO J, 32, 1183

Wang et al., 2013, A molecular genetic approach to uncovering the differential functions of dopamine D2 receptor isoforms, Dopamine: Methods in Mol Biol, 964

Fukuzawa et al., 2013, SGLT5 reabsorbs fructose in the kidney but its deficiency paradoxically exacerbates hepatic steatosis induced by fructose, PlosOne, 8, e56681

Morales et al., 2013, Utx is required for proper induction of ectoderm and mesoderm during differentiation of embryonic stem cells, PlosOne, 8, e60020

Murata et al., 2013, Contribution of myocyte enhancer factor 2 family transcription factors to BZLF1 expression in Epstein-Barr virus reactivation from latency, J Virology, 87, 10148

Liu et al., 2013, Direct and indirect roles of Fgf3 and Fgf10 in innervation and vascularisation of the vertebrate hypothalamic neurohypophysis, Development, 140, 1111

Klose et al., 2013, Fosmid-based structure-function analysis reveals functionally distinct domains in the cytoplasmic domain of Drosophila crumbs, G3, 3, 153

Delenda et al., 2013, Bio-applications derived from site-directed genome modification technologies, site-directed insertion of transgenes, Topics in Current Genetics, 23

Koayashi et al., 2013, Genetic dissection of medial habenula–interpeduncular nucleus pathway function in mice, Frot Behav Neurosci, 7, 17

Matkovic et al., 2013, The Bruchpilot cytomatrix determines the size of the readily releasable pool of synaptic vesicles, JCB, 202, 667

Hu et al., 2013, VirD: A virion display array for profiling functional membrane proteins, Anal Chem, 85, 8046

Older

Wang et al., 2006, An improved recombineering approach by adding RecA to lambda Red recombination, Mol Biotechnol, 32, 43

Wenzel et al., 2005, Heterologous expression of a myxobacterial natural products assembly line in pseudomonads via red/ET recombineering, Chem Biol, 12, 349

Glaser et al., 2005, Current issues in mouse genome engineering, Nat Genet, 37, 1187

Vetcher et al., 2005 Rapid engineering of the geldanamycin biosynthesis pathway by Red/ET recombination and gene complementation, Appl Environ Microbiol, 71, 1829

Ikeya et al., 2005, Gene disruption/knock-in analysis of mONT3: Vector construction by employing both in vivo and in vitro recombinations, Int J Dev Biol, 49, 807

Testa et al., 2004, A reliable lacZ expression reporter cassette for multipurpose, knockout-first alleles. Genesis, 38, 151

Testa et al., 2003, Engineering the mouse genome with bacterial artificial chromosomes to create multipurpose alleles. Nat Biotechnol, 21, 443

Zhang et al., 2003, Phage annealing proteins promote oligonucleotide-directed mutagenesis in Escherichia coli and mouse ES cells, BMC Mol Biol, 4, 1

Muyrers et al., 2002, Introducing Red/ET recombination: DNA engineering for the 21st Century, Gene Cloning & Expression Technologies, Biotechniques

Shimshek et al., 2002, Codon-Improved Cre recombinase (iCre) expression in the mouse, Genesis 32, 19

Voziyanov et al., 2002, A dual reporter screening system identifies the amino acid at position 82 in Flp site-specific recombinase as a determinant for target specificity, Nucleic Acids Res, 30, 1656

Muyrers et al., 2001, Recombinogenic engineering: New options for manipulating DNA Trends in Biochemical Sciences, 26, 325

Schaft et al., 2001, Efficient FLP recombination in mouse ES cells and oocytes, Genesis, 31, 6

Buchholz et al., 2001, LoxP-directed cloning: Use of Cre recombinase as a universal restriction enzyme, Biotechniques, 31, 906

Muyrers et al., 2000, ET cloning: Think recombination first, Genetic Engineering, Principles and Methods, 22, 77

Muyrers et al., 2000, Point mutation of bacterial artificial chromosomes by ET recombination, EMBO Reports, 1, 239

Hill et al., 2000, BAC trimming minimizing clone overlaps, Genomics, 64, 111

Muyrers et al., 2000, RecE/RecT and Reda/Redb initiate double stranded break repair by specifically interacting with their respective partners, Genes and Development, 14, 1971

Zhang, et al., 2000, DNA cloning by homologous recombination in Escherichia coli, Nature Biotechnology 18, 1314

Rodriguez et al., 2000, High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP, Nat Genet. 25, 139

Testa et al., 2000, Creating a transloxation: Interchromosomal translocations in mice, EMBO Reports, 1, 120

Muyrers et al., 1999, Rapid modification of Bacterial Artificial Chromosomes by ET-recombination, Nucleic Acids Res, 27, 1555

Angrand et al., 1999, Simplified generation of targeting constructs using ET recombination, Nucleic Acids Res, 27, e16

Narayanan et al., 1999, Efficient and precise engineering of a 200 kb beta-globin human/bacterial artificial chromosome in E. coli DH10B using an inducible homologous recombination system, Gene Ther, 6, 442

Ringrose et al., 1999, Quantitative comparison of DNA looping in vitro and in vivo: Chromatin increases effective DNA flexibility at short distances, EMBO J, 23, 6630

Zhang et al., 1998, A new logic for DNA engineering using recombination in E. coli, Nature Genetics, 20, 123

Schwenk et al., 1998, Temporally and spatially regulated somatic mutagenesis in mice, Nucleic Acids Res, 26, 1427

Angrand et al., 1998, Inducible transgene expression based on regulated recombination, Nucleic Acids Res, 26, 3263

Ringrose et al., 1998, Comparative kinetic analysis of Flp and Cre recombinases: Mathematical models for DNA binding and recombination, J Mol Biol, 284, 363

Ringrose et al., 1997, The Kw recombinase, an integrase from Kluyveromyces waltii, Eur J Biochem, 248, 903

Buchholz et al., 1996, A simple assay to verify the functionality of Cre and FLP recombination targets in genomic manipulation constructs, Nucleic Acids Res, 24, 3118

Buchholz et al., 1996, Different thermostabilities of FLP and Cre recombinases: Implications for applied site specific recombination, Nucleic Acids Res, 24, 4256

Logie et al., 1995, Ligand-regulated site-specific recombination, PNAS, 92, 5940

If you cannot find the answer to your problem below then please contact us or telephone 01954 210 200